Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Duplicate<Obj|All>

-

Duplicate objects


CommandArgument DatatypeDefaultMinMax
Format:Duplicate<Obj|All>Object selection SELECTION---
Python:resultlist = Duplicate<Obj|All>(selection1)
Menu:Edit > Duplicate
Related: Oligomerize , Crystallize
Required:


The Duplicate command creates copies of the selected objects and assigns them the lowest free object numbers. Currently the command can only be applied to objects containing atoms.

Example 1:
DuplicateObj 1-2

Create copies of objects 1 and 2.


Example 2:
obj = DuplicateObj 5

Create a copy of object 5 and assign its number to variable 'obj'.


Example 3:
objlist() = DuplicateAll

Create copies of all objects and assign the numbers to list 'objlist'.