Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Deriving new NOVA force field parameters

NOVA uses molecular trees to assign force field parameters. Most of the time, it is enough to follow this procedure:

  • Load a PDB file of the structure with the unknown ligand(s). If the PDB file does not contain CONECT records (no chemical bonds defined, the ligand appears as a point cloud in ball&stick display) let YASARA find the bonds (Edit > Find bonds in). In any case clean the structure (Edit > Clean), and save it in the yasara/fof directory.

  • Edit the file yasara/fof/nova.fof, search for the text 'OTHER MOLECULES' and insert the name of your PDB file below. If your PDB file also contains a protein, you should place a question mark '?' in front (this will tell YASARA to look only at new features in your structure and ignore the rest). This structure will now be used to learn equilibrium bond lengths and angles, it must therefore have an accurate covalent geometry.

Example:


;
;SOME OTHER MOLECULES
;====================
?MyStructureWithProtein.pdb
MyLigandAlone.pdb
smallmol.pdb
heparin.pdb

  • Update the force field by starting YASARA with the command line option -upd:
    
    yasara -upd
    
    
    YASARA will then recompile all force fields and tell you if something went wrong. If you do not get an error message, restart YASARA and try to initialize the simulation again.

  • If you still get the error message 'NOVA force field tree not found' and your molecule contains fused ring systems, simply use one of the other force fields which automatically detect and handle planarity.

  • You can always check that the bond types were assigned correctly by loading the PDB file and clicking on the atoms: the bond types are displayed in the lower left HUD.

  • If your residue contains unusual chemical groups that do not look like anything you find in proteins, DNA and sugars, the NOVA force field may not contain point charge definitions for the group. This will result in polar atoms without a charge. You can verify that by clicking on the polar atoms after initializing the simulation. The simulation HUD on the right lists all point charges on this atom. If there is more than one charge on an atom, you can cycle through them with <Home> and <End>. If you are really missing a charge and doing more than a quick&dirty modeling task, you must add an entry to the CHARGE_POSITION_DATA section in yasara/fof/nova.fof and recompile the force field.

  • The same principle holds for planar groups. If a group is not recognized as planar, a corresponding entry has to be added to the PLANE_CONFORMATION_PLANES section to avoid an out-of-plane distortion.

As NOVA has been optimized for proteins only, it is generally advised that you use the (Y)AMBER/YASARA force fields when working with small molecules.