Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Distance

-

Set/get distance between atoms


CommandArgumentDatatypeDefault Min Max
Format: Distance Atom selection 1,SELECTION ---
   Atom selection 2,SELECTION ---
   bound = Yes | No,STRINGNo - -
   set = new distance in ÅFLOAT ---
Python: Distance(selection1,selection2,bound,set)
resultlist = Distance(selection1,selection2,bound=None)
Menu:Edit > Geometry > Distance
Analyze > Geometry > Distance
Related: Angle , Dihedral, GroupDistance , GroupAngle, GroupDihedral
Required:


The Distance command measures or sets the distances between all pairs of atoms in the two selections.

If the Bound flag is set, only distances between chemically bound atoms will be considered.

If a new distance is specified with the Set parameter , the atom in the second selection (and all covalently connected ones) will be moved to arrive at the new distance. This requires that the distance to set is not part of a closed loop. Atoms that are not covalently bound (e.g. metals) will not be moved along, which can be fixed afterwards by additionally re-setting the distance between one coordinating atom and the metal ion.

Distances can be changed interactively from the atom context menu if two atoms are marked with white and red fireflies. Click Geometry > Distance to adjust the distance between the two atoms, or Geometry > Bond lengths to adjust up to four bond lengths that link the two marked atoms. Note that this feature is only available in YASARA Model and above.

To measure distances between arbitrary points that do not coincide with atoms (like the center of a phenyl ring) build dummy atoms at these points first, or use the GroupDistance command.

Example 1:
Distance 105,109

Calculate distance between atoms 105 and 109.


Example 2:
Distance 5,CA

Calculate distances between atom 5 and all CA atoms.


Example 3:
Distance CA,CB,bound=Yes

List all CA-CB bond lengths.


Example 4:
dis = Distance 200,300

Assign distance between atoms 200 and 300 to variable 'dis'.


Example 5:
Distance 105,109,set=2.5

Set distance between atoms 105 and 109 to 2.5 Angstroms.



Example macro:

# EXAMPLE Distance
# Requires YASARA Model
Clear
LoadPDB 1crn
Style Ribbon,Stick
for i=1.0 to 10.0 step 0.1
  # Exclude Pro and Cys (looping side-chains)
  Distance CA and not Res Cys Pro,CB and not Res Cys Pro,bound=Yes,set=(i)
  Wait 1

Figure: Result of the example macro above.