Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Dipole<Atom|Res|Mol|Obj>

-

Calculate electric dipole moments


CommandArgument DatatypeDefaultMinMax
Format:Dipole<Atom|Res|Mol|Obj> SelectionSELECTION - --
Python:resultlist = Dipole<Atom|Res|Mol|Obj>(selection1)
Menu:Analyze > Dipole moment of
Related: Charge
Required:


The Dipole command calculates the electric dipole moment of the selected atoms in the local coordinate system, using the charges assigned by the current ForceField. Dipoles calculated with the NOVA force field tend to be smaller since, since it uses reduced ionic charges.

If atoms in more than one object are selected, the dipole moment is calculated per object.

The electric dipole moment p in units of [Coulomb*meter] (the first return value) is the length of the vector P, which is defined as follows:


(1)

In this formula, q is the charge of atom i, R are its cartesian coordinates, and C is the geometric center of the selection. Multiply the result with 3e29 to obtain Debye units.

If the net charge of the selected atoms is zero, this formula yields a true dipole moment which does not depend on the choice of point C. Otherwise a dipole moment cannot be defined, and one obtains the electric moment with respect to point C instead. YASARA displays a warning in this case.

This example macro shows the dipole moment vector for a protein:

# Load the protein
Clear
LoadPDB 2sod
DelMol !O
Center
# Assign changes
Clean
ForceField Amber99
Sim Init
# True dipole moment can only be calculated with zero net charge
Charge 0
# Make sure that the object is not rotated
OriObj 1,0,0,0
# Get the dipole vector
d,dx,dy,dz = DipoleObj 1
# Arbitrary scaling factor from CoulombMeter to Angstrom
scale=0.5e29
# Show dipole moment
x,y,z = PosObj 1
ShowArrow Start=Point,(x-dx*scale),(y-dy*scale),(z-dz*scale),
          End=Point,  (x+dx*scale),(y+dy*scale),(z+dz*scale),
          Radius=1, Heads=1, Color=Green


Example 1:
DipoleObj 3

Calculate the electric dipole moment of object 3.


Example 2:
p = DipoleRes HOH 506

Calculate the electric dipole moment of residue HOH 506 and assign it to variable 'p'.


Example 3:
p,px,py,pz = DipoleRes Trp Obj 5

Calculate the combined dipole moment of all tryptophans in object 5, assign the scalar value to variable 'p' and the vector to 'px', 'py' and 'pz'.