Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

DelWater<Obj|All>

-

Delete all water molecules


CommandArgument DatatypeDefaultMinMax
Format:DelWater<Obj|All> Object selectionSELECTION ---
Python: DelWater<Obj|All>(selection1)
Menu:Edit > Delete > Waters
Related: DelRes , DelHyd
Required:


DelWaterObj acts on entire objects and is more convenient than the equivalent DelRes HOH Obj X. Use the latter construct to delete selected waters in an object.

Example:
DelWaterObj 5tim

Delete all water molecules in 5tim.