Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

DelTab

-

Delete tables


CommandArgument DatatypeDefaultMinMax
Format:DelTabTable selection SELECTION---
Python:DelTab(selection1)
Menu:Options > Table > Delete
Related: Tab , Tabulate, SelectTab , MakeTab, ShowTab , LoadTab, SaveTab , FlipTab
Required:


If the table that accepts the cells added with Tabulate is deleted, a new default table is created automatically the next time Tabulate is used.

Example 1:
DelTab default

Delete the table with name 'default' (usually number 1).


Example 2:
DelTab 2-4

Delete tables 2,3 and 4.