Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

DelRest<Obj|All>

-

Delete restraints


CommandArgument DatatypeDefaultMinMax
Format:DelRest<Obj|All>Selection SELECTION---
Python:DelRest<Obj|All>(selection1)
Menu:Simulation > Delete restraints
Related:LoadTbl, RestrainDis , RestrainDih, RestrainPot , RestrainPar, RestEnergy , RestViol, ListRest , ScaleRest, ShowRest , HideRest
Required: and the NMR Structure Determination Module


The DelRest command deletes all restraints in the selected objects, selecting individual restraints is not possible.

Example 1:
DelRestAll

Delete all restraints that have been added so far.


Example 2:
DelRestObj 5

Delete the restraints in object 5.