Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

DelBond

-

Delete covalent bonds


CommandArgument DatatypeDefaultMinMax
Format:DelBondAtom selection 1,SELECTION - --
  Atom selection 2,SELECTION - --
  LenMin = Minimum bond length in ÅFLOAT 0.0 --
Python:DelBond(selection1,selection2,lenmin=None)
Menu:Edit > Delete > Bond
Related: AddBond
Required:


The DelBond command deletes all bonds between the two atom selections.

The easiest way to delete a bond manually is by marking two bound atoms like when measuring a distance, and then clicking 'Delete > Bond' in the atom context menu of the atom marked with white fireflies.

Two types of 'bonds' are not affected by DelBond, simply because they are not true covalent bonds:

  • The graphical link between two atoms shown with the ShowTrace command, usually a Calpha trace or a DNA backbone trace. To remove such a graphical link, simply delete the covalent bond between the two residues, e.g. the peptide bond between atoms C and N. If the goal is to prevent the trace from bridging gaps in the chain, just delete all unusually long bonds together: DelBond all,all,LenMin=3

  • Pseudo-bonds used to visualize interactions with metal ions. These cylinders are created with the ShowArrow command and can consequently be removed with HideArrow.

Example 1:
DelBond 105,109

Delete any bond between atoms 105 and 109.


Example 2:
DelBond Res 50,Res 50

Delete all bonds in residue 50.


Example 3:
DelBond Res 50,Res 51

Delete peptide bond between residues 50 and 51.


Example 4:
DelBond Fe,SG

Delete all bonds between Iron and SG atoms.


Example 5:
DelBond All,All,LenMin=3

Delete all bonds longer than 3 A.