Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Del<Atom|Res|Mol|Obj|All>

-

Delete atoms


CommandArgument DatatypeDefaultMinMax
Format:Del<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Center = Yes | NoSTRING No --
Python:Del<Atom|Res|Mol|Obj|All>(selection1,center=None)
Menu:Edit > Delete
Keys:<Delete> or <Backspace>  -  Delete the marked atom or label
Related:DelImage, Clear , Reset
Required:


If the Center flag is set, the object is shifted such that its mean atom position coincides with the origin of its local coordinate system. This makes sure that rotations with the mouse feel natural. When exporting an object, these transformations can be undone by checking the 'Transform' button.

Example 1:
DelAll

Delete all objects, but leave the rest untouched (background images (Clear) and simulation parameters (Reset )).


Example 2:
DelObj 1crn 4 5-10

Delete objects 1crn, 4 and 5 to 10.


Example 3:
DelObj SimCell

Delete the simulation cell.


Example 4:
DelRes Lys

Delete all lysine residues and center the object afterwards.


Example 5:
DelRes 1-20,Center=No

Delete residues 1 to 20, but do not center the object.