Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Your guide to YASARA View



° 

Essentials

-

What you really have to know


° 

Selections

-

Tell YASARA what you want


° 

Commands

-

Tell YASARA what to do


° 

Recipes

-

Answer complex questions


° 

Run molecular dynamics simulations

° 

Refine a homology model

° 

Solve an NMR structure

° 

Create your own YASARA Movies


° 

Movies are written in Yanaconda

° 

Movies are stored in the yasara/mov directory

° 

Movies start with typical commands

° 

Movies can wait for a specified time or until you press a button

° 

Labels allow to jump back and forth between movie sections

° 

Work with YASARA and your text editor in parallel

° 

Movies can be imported from OpenOffice or PowerPoint

° 

Bitmap images can be displayed and animated

° 

Text can be displayed using 3D letters

° 

The look of the movie depends on the aspect ratio of the YASARA window

° 

Hints for using movies in important presentations


° 

Macros

-

Automate your work with Yanaconda


° 

Plugins

-

Extend YASARA with your own functions


° 

Scripts

-

Use YASARA as a Python module


° 

Troubleshooting

-

Get things going