Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Cutoff

-

Set force cutoff distance


CommandArgument DatatypeDefaultMinMax
Format:CutoffDistance = Force cutoff distance in ÅFLOAT ---
Python: Cutoff(distance)
Menu:Simulation > Force field
Related: ForceField , Longrange, Interactions , ScaleForce, SimSpeed
Required:


While in principle any cutoff distance can be specified, there is always a performance/accuracy trade-off involved. Larger cutoffs can give higher accuracies at the cost of slower simulations. Due to YASARA's built in data-structures, it is best to choose a cutoff that is a multiple of 2.62 Angstroms (i.e. 5.24, 7.86, 10.48 etc.). Immediately beyond these distances, the performance drops significantly. So a simulation with a 7.87 A cutoff will take significantly longer than one with a 7.86 A cutoff, while the accuracy will be indistinguishable. Electrostatic interactions can be calculated without a cutoff using the Particle Mesh Ewald approach activated by Longrange. The chosen cutoff then applies to the Van der Waals forces only. The Yamber force fields are optimized for a 7.86 A cutoff and long range electrostatics, the NOVA force field for a plain 10.48 A cutoff without long range electrostatics.

Example 1:
Cutoff 5.24

Set a short 5.24 A force cutoff for non-scientific animations or initial NMR structure generation.


Example 2:
Cutoff 7.86

Set a medium range 7.86 A cutoff for molecular dynamics simulations with explicit treatment of long range electrostatics using Longrange.


Example 3:
Cutoff 15.72

Set a long range cutoff.