Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Calls to built in functions can be placed anywhere within an expression

Yanaconda supports a number of built-in functions, mainly for doing math. These functions can appear anywhere in an expression. If the function argument is itself an expression, you must enclose it in parentheses. Remember to leave a space between the function name and the opening parenthesis.


for i = 0 to 180 step 60
  j = sqrt i
  k = cos (i)
  Print 'Sqrt of (i) = (j), Cos of (i) = (k)'

Sqrt of 0 = 0.00000000000000e+00, Cos of 0 = 1.00000000000000e+00
Sqrt of 60 = 7.74596669241483e+00, Cos of 60 = 5.00000000000015e-01
Sqrt of 120 = 1.09544511501033e+01, Cos of 120 = -4.99999999999969e-01
Sqrt of 180 = 1.34164078649987e+01, Cos of 180 = -1.00000000000000e+00

Unlike C and Python, trigonometric functions expect their arguments in normal degrees.

If a string is passed to the rnd function, it will randomize each alphanumeric character such that the replacement has a lower alphanumeric ASCII code. E.g. when passing the string 'ffffff', the result will be a random RGB color.

The following functions are available:
abs X Absolute value of X
acos X Arc cosine of X, returned in degrees
asin X Arc sine of X, returned in degrees
atan X Arc tangent of X, returned in degrees
cos X Cosine of X, X in degrees
count X The number of occurrences of variables with root name X and different terminal numbers
cube X Volume of a cube with length X = X*X*X
curt X Cubic root
dirname XGet the directory name of the path in string X (discarding additional filename or slash)
exp X e (the base of natural logarithms) raised to the power X
log X Natural logarithm of X
log10 X Base-10 logarithm of X
join X Join all variables with root name X to a single weak string, currently in random order
max X The maximum value in list X (all variables with root name X)
mean X The mean value of list X (all variables with root name X)
min X The minimum value in list X (all variables with root name X)
onein X A random element in list X (all variables with root name X)
ord X The ASCII code of string X, summed up if string contains more than one character
rnd X A random number in the range [0..X[. If the argument is a string, each character is randomized
round X X rounded to the closest integer
sign X The sign of X, either 1, 0 or -1.
sin X Sine of X, X in degrees
sqr X Area of a square with length X = X*X
sqrt X Square root
stddev X The standard deviation of list X (all variables with root name X)
sum X The sum of all values in list X (all variables with root name X)
tan X Tangent of X, X in degrees
trunc X The integer part of X, rounded towards zero.