Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Crystallize<Obj|All>

-

Crystallize objects to fill the unit cell


CommandArgument DatatypeDefaultMinMax
Format:Crystallize<Obj|All> Object selection, SELECTION- - -
   Center = Yes | NoSTRING Yes --
Python:resultlist = Crystallize<Obj|All>(selection1,center=None)
Menu:Edit > Crystallize
Related: Duplicate , Oligomerize
Required:


The Crystallize command adds the symmetry related copies of the selected objects to fill the crystallographic unit cell, and can thus only be applied to structures solved by X-ray crystallography. The cell itself can be shown with the Cell command.

YASARA obtains the required symmetry transformations from two sources:

  • From the REMARK 290 records in the original PDB file. This is the default.

  • From the crystallographic space group defined in the CRYST record of the original PDB file. This functionality is provided by WHAT IF and thus only available in the Twinset.

If you do not work with the Twinset, and the PDB file does not contain REMARK 290, YASARA will display an error message. REMARK 290 is an obligatory part of PDB X-ray structures, but unfortunately still missing in many of the older PDB files.

Example 1:
CrystallizeObj 2

Add all crystal symmetry related copies of object 2 and center the new objects.


Example 2:
CrystallizeAll Center=No

Crystallize all objects but do not center afterwards.


Example 3:
objlist() = CrystallizeObj 1xp2

Crystallize object 1xp2 and assign the numbers of the created objects (including the initially selected one) to 'objlist'.



Example macro:

# EXAMPLE Crystallize
# Requires YASARA Dynamics
Clear
LoadPDB 1xp2
Clean
# Add symmetry related copies of 1xp2
CrystallizeObj 1xp2
# Add the crystal cell of 1xp2
Cell Crystal,1xp2
# Wrap the atoms into the cell
Boundary periodic
ForceField Yamber2
Sim On
Sim Pause
# Show a periodic surface
Style Ribbon
ColorObj All,Blue,Cyan
SurfPar Resolution=4,Molecular=Numeric
ShowSurfRes Protein,Type=molecular,Update=dynamic,
            OutCol=AtomCol,OutAlpha=70,InCol=AtomCol,InAlpha=100
# Pick view
Pos X=14.562, Y=17.647, Z=206.940
Ori Alpha=-13.775, Beta=46.900, Gamma=-21.707

Figure: Result of the example macro above.