Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Count<Atom|Res|Mol|Obj>

-

Count selected units


CommandArgument DatatypeDefaultMinMax
Format:Count<Atom|Res|Mol|Obj> Selection SELECTION- - -
Python: result = Count<Atom|Res|Mol|Obj>(selection1)
Menu:Analyze > Count
Related: List , Span
Required:


Example 1:
CountRes Lys Obj 1

Count number of lysine residues in object 1.


Example 2:
atms = CountAtom Obj 1crn

Assign the number of atoms in object 1crn to variable 'atms'.


Example 3:
molecules = CountMol B

Assign the number of molecules named 'B' to variable 'molecules'.