Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

CorrectIso

-

Correct wrong isomeres during simulation


CommandArgumentDatatypeDefault Min Max
Format: CorrectIso Type = On | Off | byForceSTRING ---
Python: CorrectIso(Type)
Menu:Simulation > Automatic correction of > wrong isomeres
Related:CorrectCis, CorrectConv
Required:


The CorrectIso command toggles several mechanisms to avoid the appearance of wrong stereo-isomeres and to remove existing ones. Wrong stereo-isomeres can show up during unrealistic simulations at high temperature (for example simulated annealing runs for NMR structure determination) when chiral centers flip to the mirrored conformation.

The following chiral centers are currently analyzed:
Residue Atom namePotential error
All CA D-amino acid
Thr CB Mirrored side-chain
Ile CB Mirrored side-chain

The analysis is based on atom names, amino acids with incorrect atom names will not be analyzed properly.

The CorrectIso command allows to avoid and correct these problems in two ways:

  • If 'Type' is set to 'byForce', YASARA will apply a force to keep the improper dihedrals of chiral centers in the right conformation.

  • If 'Type' is set to 'On', YASARA will not only apply a force, but also check every ~250 simulation steps if the isomeres are indeed correct. If not, atoms will be moved as required, followed by a local energy minimization. This correction is skipped entirely if either the Van der Waals or Coulomb forces are switched off.

The above two correction mechanisms stay in effect until either the command 'CorrectIso Off' or 'Reset' is issued.

If you want to manually correct or even intentionally create wrong isomeres, there are two possibilities, described below using the L-/D-amino acid example:

  • Fix the CB and HA atoms, then swap their positions, most easily by selecting the CB atom and (with <Ctrl>) the HA atom, and clicking Swap > Atom positions in the atom context menu. Finally perform an energy minimization to pull the side-chain to the other side.

  • Mark the improper dihedral N-CA-C-CB and click on Geometry > Dihedral in the atom context menu. Move the entire side-chain to the other side, past the HA atom (the required improper dihedral is usually about 80 degrees). Then run an energy minimization.

Deviations from naming conventions that are not touched by this command , e.g. Val/Leu methyl groups or methylene hydrogens that got swapped. Use the CorrectConv command to correct those.

Example 1:
CorrectIso On

Correct wrong isomeres during simulation.


Example 2:
CorrectIso byForce

Apply an improper dihedral force to avoid wrong isomeres but do not move atoms to correct a problem.


Example 3:
CorrectIso Off

Do not correct wrong isomeres during simulation.