Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

CorrectConv

-

Correct naming conventions during simulation


CommandArgument DatatypeDefaultMinMax
Format:CorrectConvType = On | OffSTRING - --
Python:CorrectConv(Type)
Menu:Simulation > Automatic correction of > wrong naming conventions
Related:CorrectIso, CorrectCis
Required:


The CorrectConv command toggles the enforcement of atom naming conventions during a simulation. If an unrealistic simulation is run at high temperature (for example simulated annealing runs for NMR structure determination), pairs of atoms can change place. The result can be serious errors in the structure (cis-peptide bonds or wrong stereoisomeres , as well as simple deviations from naming conventions. Since atom names are just labels attached by humans, YASARA ignores them whenever possible, but especially NMR spectroscopists often rely on them when assigning stereo-specific restraints. If set to 'On', the CorrectConv command therefore detects and corrects the following naming problems by swapping the atoms back:
Residue Atom names Potential error
All Methylene hydrogensHydrogens not ordered according to conventions
Asn 1HD2/2HD2 Hydrogens not ordered according to conventions
Gln 1HE2/2HE2 Hydrogens not ordered according to conventions
Arg 1HH1/2HH1/1HH2/2HH2Hydrogens not ordered according to conventions
Val CG1/CG2 Flipped side-chain methyl groups
Leu CD1/CD2 Flipped side-chain methyl groups

The corrections stay in effect until either the command 'CorrectConv Off' or 'Reset' is issued.

While methylene, amide and guanidine corrections also consider unusual amino acids, the correction of methyl groups in Val and Leu relies on correct residue and atom names to function properly.

Example 1:
CorrectConv On

Correct deviations from various atom naming conventions during a simulation.


Example 2:
CorrectConv Off

Do not correct naming conventions during a simulation.