Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

CorrectCis

-

Correct cis-peptide bonds during simulation


CommandArgument DatatypeDefaultMinMax
Format:CorrectCisType = On | Off | byForce,STRING - --
  Proline = Yes | NoSTRING No --
Python:CorrectCis(Type,proline=None)
Menu:Simulation > Automatic correction of > cis-peptide bonds
Related:CorrectIso, CorrectConv
Required:


The CorrectCis command toggles several mechanisms to avoid the appearance of cis-peptide bonds and to remove existing ones.

Unrealistic simulations at high temperature (for example simulated annealing runs for NMR structure determination) can cause flips of peptide bonds. The CorrectCis command allows to avoid and correct these problems in two ways:

  • If 'Type' is set to 'byForce', YASARA will apply a force to keep the dihedral angle of the peptide bond at 180 degrees.

  • If 'Type' is set to 'On', YASARA will not only apply a force, but also check every ~250 simulation steps if the peptide bonds are indeed correct. If not, atoms will be moved as required, followed by a local energy minimization. This correction works best with the NOVA force field and is skipped entirely if either the Van der Waals or Coulomb forces are switched off.

The above two correction mechanisms stay in effect until either the command 'CorrectCis Off' or 'Reset' is issued.

Since cis-peptide bonds before prolines have a reasonable chance of being real, their correction has to be explicitly requested with the Proline flag.

Amino acids needing correction are identified via their backbone atom names, amino acids with incorrect backbone atom names will thus not be corrected .

Example 1:
CorrectCis On

Correct all cis-peptide bonds during a simulation.


Example 2:
CorrectCis On,Proline=No

Correct all cis-peptide bonds except those before a proline residue during a simulation.


Example 3:
CorrectCis byForce

Apply a force to avoid cis-peptide bonds but do not move atoms to correct a problem.


Example 4:
CorrectCis Off

Do not correct cis-peptide bonds during simulation.