Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

CoordSys

-

Set coordinate system


CommandArgument DatatypeDefaultMinMax
Format:CoordSys handed = Left | Right STRING- - -
Python: CoordSys(handed)
Menu:Options > Coordinate system
Required:


It is strongly recommended to use the more intuitive left-handed coordinate system , which most people are familiar with since highschool: The X-axis points to the right and the Y-axis upwards, as you would draw them on paper. The Z-axis then points into the screen, objects with a larger Z-coordinate are further away. The option to use a right-handed coordinate system is mainly provided for crystallographers, who are used to think in the 'right' way. If you point your thumb in the direction of an axis, the remaining fingers define the sense of positive rotations. Changing the coordinate system clears the entire scene. Loading a scene sets the coordinate system to the handedness of the scene.

Example 1:
CoordSys Left

Choose a left handed coordinate system. The X-axis points to the right, the Y-axis upwards and the Z-axis into the screen. A positive rotation angle is defined by your left hand.


Example 2:
CoordSys Right

Choose a right handed coordinate system. The X-axis points to the left, the Y-axis upwards and the Z-axis into the screen. A positive rotation angle is defined by your right hand.