Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ConsolePar

-

Set console parameters


CommandArgument DatatypeDefaultMinMax
Format:ConsolePar Font = Small | Large, STRING- - -
   Height = Height of the extended console in percent of window height, FLOAT-0.0 100.0
  Antialias = Yes | No STRING-- -
Python:ConsolePar(font,height,antialias)
Menu:Window > Console > Parameters
Related:Console
Required:


The ConsolePar command configures the appearance of the text console at the bottom of the YASARA window.

The Font and Antialias parameters define the font to be used, either with or without antialiasing.

The Height parameter sets the hight of the extended console which appears when <Space> is pressed twice in a row.

Example 1:
ConsolePar Font=Large,Antialias=Yes

Choose a large antialiased console font.


Example 2:
ConsolePar Height=50%

If you press <Space> twice to bring up the extended console, it will cover half of the screen.