Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Console

-

Switch console on/off


CommandArgument DatatypeDefaultMinMax
Format:ConsoleFlag = On | OffSTRING - --
Python:Console(flag)
Menu: Window > Console
Keys:<Space>  -  Bring up the console
<Space> again  -  Extend the console
Related:ConsolePar, Menu , HUD, FullScreen
Required:


The Console command allows to switch off the console, which is mainly required when running a multimedia presentation or an analysis script that makes heavy use of the Yanaconda macro language.

When the console is switched off, macros execute significantly faster, because the screen is not updated anymore, except when the Wait command is issued. To gain additional speed, the Undo /Redo functions are also disabled. If switched off, the only data echoed to the console are the results of analysis commands.

Example 1:
Console Off

Never show the console, except if the <SPACE> key is pressed.


Example 2:
Console On

Show the console when running a macro or executing certain commands that give an output.