Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Compare<Atom|Res>

-

Compare selections


CommandArgument DatatypeDefaultMinMax
Format:Compare<Atom|Res>Selection 1,SELECTION - --
  Selection 2SELECTION---
Python:Compare<Atom|Res>(selection1,selection2)
Menu:Analyze > Compare
Related: RMSD , Sup
Required:


The Compare command matches the two selections and lists any differences found, i.e. atoms or residues present in only one of the two selections.

This command is especially helpful to locate unexpected differences in atoms or residues that may lead to errors during superpositions or RMSD calculations.

Example 1:
CompareRes Protein Obj 1,Protein Obj 3

Compare the protein residues in objects 1 and 3, listing any differences.


Example 2:
CompareAtom Res His Obj 1,Res His Obj 2

Compare the atoms in the histidine residues of objects 1 and 2. If hydrogens are present, this will list differences in protonation states.