Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ColorSurf<Obj|All>

-

Color surface


CommandArgument DatatypeDefaultMinMax
Format:ColorSurf<Obj|All> Object selection,SELECTION ---
   Type = VdW | Molecular | Accessible | All,STRINGAll--
  OutCol = Color used for outside,RGBCOLOR ---
  OutAlpha = alpha blending factor for the outside, FLOAT-0.0100.0
  InCol = Color used for inside, RGBCOLOROutCol--
  InAlpha = alpha blending factor for the inside,FLOATOutAlpha 0.0 100.0
   Specular = Yes | NoSTRING Yes --
Python:ColorSurf<Obj|All>(selection1,Type,outcol,outalpha,incol=None,inalpha=None,specular=None)
Menu:View > Color > Surface
Related: ShowSurf , HideSurf, SurfPar , AddEnv, RemoveEnv , ShowESP
Required:


The ColorSurf command colors the surfaces of selected objects in various ways, including the color of the electostatic potential ESP or the color of the nearest atom AtomCol. The latter option allows to transfer the many different atom coloring schemes to surfaces.

The supported options depend on the way the surface was created : Static surface objects are not directly related to the atoms from which they originated, so the two special colors 'AtomCol' and 'ESP' must be selected immediately when creating the surface, not afterwards with ColorSurf.

If the command extension is 'All', the chosen color becomes the new default for all subsequent surfaces created with ShowSurf when explicit color information is omitted.

Surfaces can only be colored on the object level. If you need to subdivide the surface into differently colored regions, there are two options:

  • Choose 'AtomCol' and color the atoms as required. The surface then reflects the atom colors. If you want different atom colors, hide the atoms and load the object a second time.

  • Split the object into smaller fragments. Each child object can have its own surface colors. Note however that surfaces of different objects do not interact with each other.

Hints for coloring by electrostatic potential :

  • The electrostatic potential can only be evaluated at those surface points that are inside the periodic simulation cell. The potential is calculated according to the selected force field. If the ESP is calculated in vacuo, electrostatic effects will be overestimated and appear longer ranged than they actually are. YASARA does currently not include implicit solvent molecules as known from Boundary Element or Poisson-Boltzmann methods.

If coloring by electrostatic potential fails and the surface stays white, go through the following checklist:


Example 1:
ColorSurfAll VdW,Yellow

Color all VdW surfaces yellow and make this the new default.


Example 2:
ColorSurfObj 2,Molecular,AtomCol

Color the molecular surface of object 2 like the closest atom.


Example 3:
ColorSurfObj 3,Accessible,ESP

Color the solvent accessible surface of object 3 by electrostatic potential. Download the movie 'Surfaces III' to see how it's done in practice.


Example 4:
ColorSurfObj 1crn,Accessible,OutCol=Green,InCol=Yellow,Specular=No

Color the solvent accessible surface of object 1crn green outside, yellow inside and do not show specular light reflections.


Example 5:
ColorSurfAll Molecular,AtomCol,50,Gray,100

Color all molecular surfaces by atom color outside and gray inside. Make them half transparent when looked at from the outside, and make this the new default.