Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ColorPar

-

Set default color parameters


CommandArgumentDatatypeDefault Min Max
Format: ColorPar Scheme = Element | SecStr | BFactor | Occupancy | Property,STRING---
  Name = AnyElement | Helix | Strand | Turn | Coil | Min | Max,STRING - --
  Color = New default color, BOWCOLOR---
  Value = Value corresponding to the chosen color INT ---
Python:ColorPar(scheme,name,color,value)
Menu:View > Color > Parameters
Related: Color
Required:


The ColorPar command only changes the chosen coloring scheme, but does not color any atoms by itself. So after changing for example the default color for carbon, you have to reassign the colors using the command 'Color Element'.

As default element colors, YASARA currently only supports the seven standard colors blue, magenta, red, yellow, green, cyan and gray. Other colors would slow down YASARA's graphics engine.

Example 1:
ColorPar Element,Carbon,Cyan

Choose cyan as the default color for carbon atoms.


Example 2:
ColorPar SecStr,Helix,Blue

Choose blue as the default color for helical regions.


Example 3:
ColorPar BFactor,Max,Yellow,80

When coloring by BFactor, atoms with values >=80 will be colored yellow.


Example 4:
ColorPar Occupancy,Min,Blue,30

When coloring by occupancy, atoms with values <=30 will be colored blue.


Example 5:
ColorPar Property,Max,Green,1000

When coloring by property value, atoms with values >=1000 will be colored green.