Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ColorHBo

-

Color hydrogen bonds


CommandArgument DatatypeDefaultMinMax
Format:ColorHBo Color = Color used for hydrogen bonds,RGBCOLORcurrent color - -
   Alpha = Alpha value in percent, INT50 1 100
   Inherit = Yes | NoSTRING No --
Python:ColorHBo(color=None,alpha=None,inherit=None)
Menu:View > Color > Hydrogen bonds
Related:ShowHBo, HideHBo , Color, ColorBG
Required:


Hydrogen bonds normally all get the same standard color, unless the 'Inherit' flag is set. In this case, hydrogen bonds inherit the atom color if donor hydrogen and acceptor atom have the same color.

Example 1:
ColorHBo Yellow,Alpha=100

Color hydrogen bonds yellow, showing them completely opaque.


Example 2:
ColorHBo Blue,Alpha=20

Color hydrogen bonds blue, showing them almost completely transparent.


Example 3:
ColorHBo Green,Alpha=50,Inherit=Yes

Color hydrogen bonds green, showing them half transparent. If donor hydrogen and acceptor have the same color, the hydrogen bond inherits this color.