Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ColorFog

-

Color fog


CommandArgument DatatypeDefaultMinMax
Format:ColorFog Color = Color used for fogRGBCOLOR ---
Python: ColorFog(color)
Menu:View > Lighting
Related: Fog , FontFog, LightSource
Required:


The ColorFog command sets the fog color, i.e. the color assigned to distant objects if Fog is enabled. This helps to improve the perception of depth, together with ambient lighting and shadows .

Example 1:
ColorFog Black

Let distant atoms fade to black.

Example 2:
ColorFog Green

Let distant atoms fade to green.