Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ColorBonds

-

Color bonds


CommandArgument DatatypeDefaultMinMax
Format:ColorBonds Color = Color used for bonds in balls&sticksBOWCOLOR-- -
Python:ColorBonds(color)
Menu:View > Color > Bonds
Related:Color, ColorHBO
Required:


The ColorBonds command sets the color for all covalent bonds between atoms shown in BallStick style.

In addition to the standard rainbow colors, two additional color options are provided:

  • Element colors the bonds like the two atoms forming the bond. If the atom colors differ, the bond color changes halfway between.

  • Order colors the bonds according to the bond order. How bond orders are mapped to colors is explained at the AddBond command.


Example 1:
ColorBonds Gray

Color all bonds in balls&sticks gray.


Example 2:
ColorBonds Element

Color every bond like the bonded atoms.


Example 3:
ColorBonds Order

Color all bonds in balls&sticks such that the bond order is indicated.



Example macro:

# EXAMPLE ColorBonds
Clear
LoadPDB 1crn
Style BallStick
ColorRes All,Red,Yellow,Segments=No
ColorBonds Grey
ColorBG Black,Red,Black,Yellow
PosObj 1,Z=14
OriObj 1,21,311,-22

Figure: Result of the example macro above.