Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ColorBG

-

Color background


CommandArgument DatatypeDefaultMinMax
Format:ColorBGTopLeft = Color in top left corner,RGBCOLOR ---
   BottomLeft = Color in bottom left corner,RGBCOLOR TopLeft color--
  TopRight = Color in top right corner,RGBCOLORTopLeft color - -
   BottomRight = Color in bottom right colorRGBCOLORBottomLeft color - -
Python: ColorBG(topleft,bottomleft=None,topright=None,bottomright=None)
Menu:View > Color > Background
Related: Color , ColorHBo
Required:


The ColorBG command sets up to four background colors, which will be assigned to the four corners of the screen and interpolated in between.

Example 1:
ColorBG Red

Color the entire background red.


Example 2:
ColorBG Blue,White

Show a vertical color gradient, blue at the top and white at the bottom.


Example 3:
ColorBG Blue,Blue,White,White

Show a horizontal color gradient, blue on the left side and white on the right side.


Example 4:
ColorBG Red,Green,Blue,Magenta

Show a color gradient with four different corner colors.


Example 5:
ColorBG Cycle

Hidden feature: show a color cycling rainbow background.



Example macro:

# EXAMPLE ColorBG
Clear
LoadPDB 1crn
Pos Z=20
Style Ribbon
ColorBG Black,Green,Yellow,Magenta

Figure: Result of the example macro above.