Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Clean<Obj|All>

-

Clean objects for molecular dynamics simulation


CommandArgument DatatypeDefaultMinMax
Format:Clean<Obj|All>Object selection SELECTION---
Python:Clean<Obj|All>(selection1)
Menu:Edit > Clean
Related:AddHyd , AddTer, Link , SwapRes, TypeBond
Required:


The Clean command performs a number of operations that prepare the molecule for a molecular dynamics simulation, some of which are accessible via other commands:
  • Delete NMR dummy Q atoms (element 0).
  • Detect missing bonds and add them.
  • Rebuild side-chains with missing atoms
  • Delete terminal residues with incomplete backbone, that often occur in X-ray structures when the chain enters a disordered region.
  • Delete atoms that are present more than once at alternate locations, keeping those with the highest occupancy.
  • Delete molecules that overlap significantly with other molecules and are most likely the result of incorrect PDB format usage, like 1GTV.
  • Delete residues that overlap significantly with other residues and are most likely slightly different ligands bound to the same active site, e.g. BTN/BTQ in 2F01.
  • Make external single atoms bound to a residue part of this residue, for example the three oxygens bound to Cys 25 in 9PAP.
  • Add terminal oxygens
  • Reassign bond orders.
  • Add missing hydrogens (hints how to handle unwanted hydrogens can also be found there).
  • Correct hydrogen names
  • Correct incorrectly shifted atom names
  • Correct hydrogen naming conventions for methylene, amide and guanidine hydrogens to facilitate stereospecific NOE assignments
  • Check and correct flipped CG and CD atom names in Val and Leu residues
  • Check and correct OT1/OT2 atom names in amino acids
  • Check and correct bond orders and oxygen atom names in (de)protonated carboxyl groups
  • Replace seleno-methionine with methionine.
  • Add cysteine bridges between close CYS SG atoms that do not already carry a hydrogen.
  • Sort backbone and side-chain atoms.

Example:
CleanObj 1crn

Prepare object 1crn for simulation.