Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

CheckBoxMenu[1-5]

-

Add a menu allowing to toggle 1 to 5 options

This keyword adds a window with one to five check boxes, that can be activated individually. This allows to toggle up to five independent options, you must specify a general explanation for the user and then one additional text for every check box.

The state of the jth check box in the ith selection menu can be accessed by the Python plugin as yasara.selection[i].checkbox[j] (see below).

Example for a menu with two check boxes:

MainMenu: NMR
  PullDownMenu: _L_ist restraints
    CheckBoxMenu2: List distance and dihedral angle restraints
      Text: Select the type of restraints to list
      Text: Distance restraints
      Text: Dihedral restraints (Checked)

By default, all boxes are unchecked. To check a box, add the text '(Checked)' at the end as in the example above.