Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Charge<Atom|Res|Mol|Obj|All>

-

Set/get the summed up charge


CommandArgument DatatypeDefaultMinMax
Format:Charge<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   e = Target net chargeFLOAT - --
Python:Charge<Atom|Res|Mol|Obj|All>(selection1,e)
resultlist = Charge<Atom|Res|Mol|Obj|All>(selection1)
Menu: Simulation > Charge
Analyze > Charge
Keys:<Home>  -  Display previous atom charge in the simulation HUD
<End>  -  Display next atom charge in the simulation HUD
Related:ShowESP, Energy , Dipole
Required:


The Charge command gets or sets the net charge of the selected atoms.

If no charge is specified, the Charge command returns the summed up net charge of the atom selection. The charge(s) of individual atoms are also displayed in the simulation HUD.

If a target charge is specified explicitly, the charges of the selected atoms are shifted such that the summed up net charge matches the target charge. Changes made to the atom charges this way stay valid until the next force field parameter assignment (which is required after modifying the soup, e.g. by deleting atoms).

Example 1:
ChargeAtom 124

Get the charge of atom 124.


Example 2:
ChargeMol A

Get the net charge of molecule A.


Example 3:
charge = ChargeObj 3

Assign the net charge of object 3 to variable 'charge'.


Example 4:
chargelist() = ChargeAtom Mol A

Assign the charges of the atoms in molecule A to 'chargelist'.


Example 5:
chargelist() = ChargeRes Obj 1crn

Assign the net charges of the residues in object 1crn to 'chargelist'.


Example 6:
ChargeAtom 200,0

Set the charge of atom 200 to 0.


Example 7:
ChargeObj 1crn,1

Shift the charges in object 1crn such that the net charge is 1.


Example 8:
ChargeRes Obj 1crn,0

Shift the charges in all residues of object 1crn such that each residue has a net charge of 0.


Example 9:
ChargeAtom Obj 1crn,0

Set all atom charges in object 1crn to 0.