Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Center<Atom|Res|Mol|Obj|All>

-

Center atoms


CommandArgument DatatypeDefaultMinMax
Format:Center<Atom|Res|Mol|Obj|All> Selection SELECTION- - -
Python: Center<Atom|Res|Mol|Obj|All>(selection1)
Menu:Edit > Center
Related: Transform , Transfer, MoveAtom
Required:


The Center command shifts the positions (in the local coordinate system ) of all atoms in the object such that the mean position of the selected atoms coincides with the origin. At the same time, Center shifts the global object position in the opposite direction, so that the net effect visible on screen is zero.

Centering an object makes sure that rotations with the mouse feel natural, since the object rotates about its geometric center.

Centering on an atom or residue is helpful to focus on a certain region of interest in an object.

If the scene consists of more than one object, YASARA rotates the view around the geometric center of all objects in the global coordinate system. The following options are available to ensure that YASARA nevertheless rotates around a certain atom:

  • Mark the atom and hold down the <Ctrl> key while rotating. This is the only option if a simulation cell is present.

  • Grab only the object containing the atom for rotation by clicking on its name in the top right object HUD.

  • Join the objects, then center on the atom.

CenterAll behaves a bit differently: instead of centering all objects independently (like CenterObj all), this command centers all objects together. This only makes sense if all objects share the same position in the global coordinate system. CenterAll is helpful after loading multiple PDB files with centering disabled, since it keeps the superposition intact.

If you save the object again as a PDB file later , and do not want the centering to affect the atom coordinates, check the 'Transform' button. This tells YASARA do reverse all coordinate transformations including the centering.

Note that the 'mean position' shifted by the Center command is simply the average of the atom positions. It is not weighted by the atom masses, so it it just very close to but not identical to the center of mass.

Example 1:
CenterObj Crambin

Move Crambin's atoms such that the mean atom position is at 0/0/0 (the origin of its local coordinate system ).


Example 2:
CenterObj 2-5

Move the atoms in objects 2 to 5 such that the mean atom positions are at 0/0/0.


Example 3:
CenterObj all

Move the atoms in all objects such that all mean atom positions are at 0/0/0.


Example 4:
CenterAll

Move all atoms such that their common mean atom position is at 0/0/0.


Example 5:
CenterAtom 5284

Move the atoms in the object containing atom 5248 such that atom 5248 is at 0/0/0.


Example 6:
CenterRes Lys 50

Move the atoms in all objects containing residues named Lys 50 such that the mean atom positions of these residues are at 0/0/0.