Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Controlling a simulation

These keys only work in YASARA Dynamics and above.

F10 Change simulation temperature control
Ctrl+F10 Change simulation temperature control, reversed direction
F11 Pause/continue simulation
Ctrl+F11 Continue a paused simulation for one single step
F12 Switch simulation on/off
1..9 Set pulling force (not on numeric keypad)
Ctrl+RightButton Pull the marked atom toward the mouse pointer (during simulations)
Ctrl+LeftButton+RightButtonPull the object containing the marked atom toward the mouse pointer (during simulations)
Ctrl+MiddleButton Pull the object containing the marked atom toward the mouse pointer (during simulations)

In MacOSX, the function keys F10 to F12 are normally occupied by Expose. If you do not want to reconfigure its keybindings, you can alternatively use the three keys just below on a typical Apple keyboard: '0' instead of F10, and then the two keys to the right instead of F11 and F12 (the actual characters printed on these keys depend on your location). If you use a MacBook trackpad, you can pull the marked atom by holding down 'Command' and the trackpad button.