Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Citing YASARA, its algorithms and force fields

If you use YASARA in published work, please add the appropriate references and send us a reprint!

If you...

  • generally use YASARA for molecular graphics etc., or specifically energy minimize proteins with the NOVA force field:

Increasing the precision of comparative models with YASARA NOVA - a self-parameterizing force field

Krieger E, Koraimann G, Vriend G (2002) Proteins 47,393-402

  • run simulations with YASARA (if you use force fields other than Yamber, e.g. Amber, please also cite the respective paper listed below).

Making optimal use of empirical energy functions: force field parameterization in crystal space

Krieger E, Darden T, Nabuurs S, Finkelstein A, Vriend G (2004) Proteins 57,678-683

Fast empirical pKa prediction by Ewald summation

Krieger E, Nielsen JE, Spronk CA, Vriend G (2006) J.Mol.Graph.Model. 25,481-486

  • run simulations with the Amber94 force field:

A Second Generation Force Field for the Simulation of Proteins, Nucleic Acids, and Organic Molecules

Cornell WD, Cieplak P, Bayly CI, Gould IR, Merz Jr. KM, Ferguson DM, Spellmeyer DC, Fox T, Caldwell JW, Kollman PA (1995) J. Am. Chem. Soc. 117, 5179-5197

  • run simulations with the Amber96 force field:

The Development/Application of a 'Minimalist' Organic/Biochemical Molecular Mechanic Force Field using a Combination of ab Initio Calculations and Experimental Data, in Computer Simulation of Biomolecular Systems

Kollman P, Dixon R, Cornell W, Fox T, Chipot C and Pohorille A (1997) in Computer Simulation of Biomolecular Systems, van Gunsteren WF, Weiner PK, Wilkinson AJ eds. 3, 83-96

  • run simulations with the Amber99 force field:

How well does a restrained electrostatic potential (RESP) model perform in calculating conformational energies of organic and biological molecules?

Wang J, Cieplak P, Kollman PA (2000) J.Comput.Chem. 21,1049-1074

  • run simulations with long-range electrostatics (Particle Mesh Ewald):

A smooth particle mesh Ewald method

Essman U, Perera L, Berkowitz ML, Darden T, Lee H, Pedersen LG (1995) J. Chem. Phys.;b 103, 8577-8593

  • simulate small molecules with the General Amber Force Field (GAFF):

Development and Testing of a General Amber Force Field

Wang J, Wolf RM, Caldwell JW, Kollman PA and Case DA (2004) J Comput Chem 25, 1157-1174

  • simulate small molecules with AM1BCC/AutoSMILES point charges:

Fast, efficient generation of high-quality atomic charges. AM1-BCC model: II. Parameterization and validation

Jakalian A, Jack DB and Bayly CI (2002) J Comput Chem 23,1623-1641

  • use the GLYCAM force field parameters for carbohydrates:

Molecular mechanical and molecular dynamical simulations of glycoproteins and oligosaccharides. 1. GLYCAM_93 parameter development.

Woods RJ, Dwek RA, Edge CJ, Fraser-Reid B (1995) J. Phys. Chem. 99,3832-3846

  • simulate sugars with sulfate groups:

Force field parameters for sulfates and sulfamates based on ab initio calculations: extensions of AMBER and CHARMm force fields.

Huige CJM, Altona C (1995) J.Comp.Chem. 16,56-79

  • optimize small molecules using quantum chemistry:

MOPAC: A semiempirical molecular orbital program

Stewart JJP (2000) J.Comp.Aided Mol.Des. 4,1-103

  • if the optimization is performed using implicit solvent:

Conductor-like screening model for real solvents: a new approach to the quantitative calculation of solvation phenomena

Klamt A (1995) J.Phys.Chem. 99, 2224-2235

  • create analytic molecular surfaces with the MSMS program:

Reduced surface: an efficient way to compute molecular surfaces

Sanner MF, Spehner JC, Olson AJ (1996) Biopolymers 38,305-320

  • analyze electrostatics using the Poisson Boltzmann solvation model:

Electrostatics of nanosystems: application to microtubules and the ribosome

Baker NA, Sept D, Joseph S, Holst MJ, McCammon JA (2001) Proc.Natl.Acad.Sci.USA 98,10037-10041

Testing similarity measures with continuous and discrete protein models

Wallin S, Farwer J, Bastolla U (2003) Proteins 50 ,144-157

  • check proteins with the 'Check' command (Twinset):

Errors in protein structures

Hooft RWW, Vriend G, Sander C, Abola EE (1996) Nature 381,272

  • align proteins with MOTIF (Twinset):

Detection of common three-dimensional substructures in proteins

Vriend G, Sander C (1991) Proteins 11,52-58

  • align proteins with the SHEBA plugin:

Protein structure alignment using environmental profiles

Jung J, Lee B, (2000) Protein Eng. 13,535-543

  • sample proteins in cartesian space with the CONCOORD plugin:

Prediction of protein conformational freedom from distance constraints de Groot BL, van Aalten DMF, Scheek RM, Amadei A, Vriend G and Berendsen HJC (1997) Proteins 29,240-251

  • run parallel jobs using the Models@Home cluster system:

Models@Home: distributed computing in bioinformatics using a screensaver-based approach

Krieger E, Vriend G (2002) Bioinformatics 18, 315-318

  • publish ray-traced images:

Add a note to the figure caption: 'Molecular graphics created with YASARA (www.yasara.org) and PovRay (www.povray.org)'.