Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

CD

-

Change working directory


CommandArgument DatatypeDefaultMinMax
Format:CDNew working directory, STRING---
  OnStartUp = Yes | NoSTRING No --
Python:CD(noname1,onstartup=None)
Menu:Options > Working directory
Related: Shell , PWD, DelFile
Required:


The CD command changes the current working directory, where YASARA looks first when loading files.

If the OnStartUp parameter is set to 'Yes', YASARA will always change to the chosen directory on startup. Alternatively, you can...

  • Open a terminal/MSDOS command prompt, go to this directory and run YASARA from there.

  • Create a shortcut to YASARA on the desktop, and specify the working directory in the shortcut properties.

Example 1:
CD /home/yasara

Change working directory to /home/yasara.


Example 2:
CD ..

Go up one directory.


Example 3:
CD (MacroDir)

Change to the directory containing the currently running macro.