Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

BuildRes

-

Build single residue


CommandArgument DatatypeDefaultMinMax
Format 1:BuildRes Name = Amino acid residue name,STRING ---
   Psi = Psi angle in degrees, FLOAT180.0 --
  Center = Yes | NoSTRINGYes- -
Format 2:BuildResName = Nucleotide residue name, STRING---
  Alpha = Alpha angle in degrees,FLOAT -46.85--
   Beta = Beta angle in degrees,FLOAT -146.06--
   Gamma = Gamma angle in degrees, FLOAT36.41 --
  Center = Yes | NoSTRINGYes- -
Python:result = BuildRes(name,psi=None,center=None)
result = BuildRes2(name,alpha=None,beta=None,gamma=None,center=None)
Menu:Edit > Build > Residue
Related: BuildMol , BuildAtom, AddRes
Required:


The BuildRes command creates a single amino acid or nucleotide residue with the specified name as a new object.

After building the first residue with BuildRes , you can use AddRes to extend the peptide or nucleic acid.

Depending on the chosen residue name, the command expects a different selection of dihedral angles.

Building an amino acid:

The residue name can be any of the 20 amino acids in three letter code, as well as one of the special residue names listed here.

The Phi/Psi angles corresponding to the various secondary structure types can be found here.


# EXAMPLE: BUILD A HELIX OF ALANINES
phi = -50
psi = -50
# BUILD THE FIRST RESIDUE
peptide = BuildRes Ala,(psi)
# EXTEND THE PEPTIDE
for i=2 to 10
  AddRes Ala,(peptide),Phi=(phi),Psi=(psi)

Building a nucleotide:

The residue name can be any of the four RNA nucleotides A, U, G and C, or one of the four DNA deoxy-nucleotides DA, DT, DG and DC. The latter four residue names match the new PDB format version 3.0.

The dihedral angles Alpha, Beta and Gamma are described in more detail here.

Example 1:
BuildRes Name=Arg,Psi=50

Build a new object consisting of one arginine residue with a carboxyl terminus and a Psi angle of 50 degrees.


Example 2:
BuildRes Name=DA,Alpha=-40,Beta=135,Gamma=35

Build a new object consisting of one deoxy-adenosine nucleotide in standard B-DNA conformation.


Example 3:
obj = BuildRes Cys

Build a new object consisting of one cysteine residue with a carboxyl terminus and a Psi angle of 180 degrees and assign its number to variable 'obj'.



Example macro:

# EXAMPLE BuildRes
# Requires YASARA Model
Clear
BuildRes His,Psi=50
BallStickAtom Sidechain
Pos Z=5

Figure: Result of the example macro above.