Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

BuildMol

-

Build peptide chain


CommandArgument DatatypeDefaultMinMax
Format:BuildMol Filename = PDB or FASTA filenameSTRING ---
Python: result = BuildMol(filename)
Menu:Edit > Build > Molecule
Related: BuildRes , BuildAtom
Required:


The BuildMol command creates a stretched out protein or nucleic acid molecule based on a sequence read from either a PDB file (the SEQRES record, not the coordinate section) or a FASTA file.

The file format is recognized automatically, independent of the actual file extension. In a FASTA file, nucleic acid sequences must be specified using lower case letters. If the sequence contains 't', YASARA will build DNA, if it contains 'u', YASARA will build RNA.

Other kinds of polymers (e.g. sugars) must be built manually, for example with your own toolbox:

  • Load or create the individual monomer units as separate objects, arrange them at the bottom of the screen and save this scene as your custom toolbox.

  • To build a new polymer, load the toolbox scene, click Edit > Duplicate > Object and select the first monomer to start.

  • Now enter the polymer sequence: hold down <Alt> or Tab and click on the individual monomer units to duplicate them.

  • Sequentially grab the duplicated monomer units with the <Shift> key, choose the required relative orientations.

  • Click Edit > Join > Objects to create a single polymer object.

The BuildMol command is often used in NMR structure determination to create the initial, linear peptide chain. To ease the communication with other programs like XPLOR & ARIA, that work with segments instead of molecules, YASARA checks if the first line in the FASTA sequence file specifies a segment ID '>SEGID=MyID' and sets the segment name accordingly.

Example 1:
BuildMol 1crn.pdb

Build a new object containing a stretched out peptide chain using the sequence found in the SEQRES record of PDB file pdb/1crn.pdb.


Example 2:
BuildMol sequence.fasta

As above, but read the sequence from the FASTA file sequence.fasta.


Example 3:
obj = BuildMol 1crn

Build a new object containing a stretched out peptide chain using the sequence found in the SEQRES record of PDB file pdb/1crn.pdb and assign its number to variable 'obj'.



Example macro:

# EXAMPLE BuildMol
# Requires YASARA Model
Clear
BuildMol 1crn
StickAtom Sidechain

Figure: Result of the example macro above.