Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

BuildLoop

-

Build central or terminal loop


CommandArgumentDatatypeDefault Min Max
Format: BuildLoop Atom selection start of loop or 'None',SELECTION-- -
   Sequence = Amino acid sequence of the loop in 1 letter code, STRING---
  Atom selection end of loop or 'None',SELECTION - --
  Structures = Number of loops to build,INT1 - -
   Mutate = Yes | No,STRING Yes --
  Bumpsum = Maximum allowed sum of all loop backbone bumps in Å,FLOAT1.0--
  SecStr = Required secondary structure H E T C STRINGAny--
Python:resultlist = BuildLoop(selection1,sequence,selection2,structures=None,mutate=None,bumpsum=None,secstr=None)
Menu:Edit > Build > Loop
Related: BuildLoopDB , SampleLoop
Required:


The BuildLoop command either bridges a gap in the peptide chain or extends the chain at the N- or C-terminal end.

Loops a built based on a search through a non-redundant set of the PDB (90% sequence identity cutoff, resolution better than 2.5 A). The top scoring loops are chosen so that there are no bumps with atoms in the structure, the start and end anchor points superpose well on those specified, and the sequence and secondary structure in the loop region is very similar to the one specified. Loops are not required to be true loops, it is easily possible to build an alpha helix using the BuildLoop command.

The side-chains of those residues that are identical in the loop sequence and the PDB hit are copied to the loop structure, the other residues are either modeled as alanines (parameter Mutate=No) or mutated as requested, but with a default side-chain conformation (parameter Mutate=Yes).

Since scanning a few thousand PDB files can take a few minutes, YASARA also supports an instantaneous search using a quick access index of the PDB. This index can only be used if the three backbone atoms C-N-CA of two consecutive residues are selected as N-terminal anchor, and the atoms CA-C-N of another two consecutive residues as the C-terminal anchor. Look at the first example below for details.

Example 1:
BuildLoop C Res 31 or N CA Res 32,ACRKHIVRFD,CA C Res 38 or N Res 39,Structures=12,Mutate=No

Find the 12 best loops of 10 residues where the first two fit on top of the three atoms C-N-CA of residues 31-32 and the last two fit on top of the three atoms CA-C-N of residues 38-39, and insert the middle six residues in between, modeling sequence mismatches as Ala. The search is done quickly using an index.


Example 2:
BuildLoop CA Res 40-44,FREACRKHVRF,None,12,Mutate=Yes

Find the 12 best loops of 11 residues where the first five fit on top of the CA atoms of residues 40-44, and add the last six residues after residue 44, modeling sequence mismatches as requested.


Example 3:
objlist() = BuildLoop CA Res 40-44,FREACRKHVRF,None,12,Mutate=Yes,SecStr=HHHHHHH**CC

As above, but the first seven residues should have helical secondary structure, the last two coil. Assign the number of the created objects to 'objlist'.



Example macro:

# EXAMPLE BuildLoop
# Requires YASARA Structure
Clear
LoadPDB 1crn
PosObj 1crn,Y=-7,Z=22
OriObj 1crn,Alpha=80,Beta=100
# Delete 4 residues in 1crn
DelRes 19-22
BuildLoop C Res 17 or N CA Res 18,Sequence=RLPGTPEA,CA C Res 23 or N Res 24,Structures=10,Mutate=Yes,SecStr=HHCCCHHH
DelObj 1
Style Trace
Stick
Color SecStr

Figure: Result of the example macro above.