Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

BuildAtom

-

Build single atom


CommandArgument DatatypeDefaultMinMax
Format:BuildAtom Element = Element name or number,STRING ---
   Atom selectionSELECTION ---
Python: result = BuildAtom(element,selection1)
Menu:Edit > Build > Atom
Related: BuildMol , BuildRes
Required:


Example 1:
BuildAtom Na

Build a new object consisting of one sodium atom.


Example 2:
obj = BuildAtom 8

Build a new object consisting of one oxygen atom and assign its number to variable 'obj'.


Example 3:
BuildAtom Dummy,CG CD? CE? CZ Res Phe 10

Build a dummy atom at the center of the phenyl ring of residue 10, which helps to measure distances.



Example macro:

# EXAMPLE BuildAtom
# Requires YASARA Model
Clear
BuildAtom Oxygen
Pos Z=5

Figure: Result of the example macro above.