Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Boundary

-

Set cell boundary


CommandArgument DatatypeDefaultMinMax
Format:Boundary Type = Periodic | Wall STRING- - -
Python: Boundary(Type)
Menu:Simulation > Define simulation cell
Related:Sim, Cell
Required:


You can only select a wall boundary if the simulation cell is orthorhombic (all angles 90 degrees).

Example 1:
Boundary Wall

Let the simulation cell consist of rigid walls, atoms bumping into them will be reflected back.


Example 2:
Boundary periodic

Let the simulation cell consist of "teleporter" walls, atoms going out on one side will come in on the other side.