Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Bond

-

a covalent link between two atoms with pH dependent order

While chemistry knows many different kinds of bonds, YASARA uses the term 'bond' only for classical covalent bonds. Bonds with a high ionic character, e.g. between and to metal ions, are not treated as bonds. Instead, molecular dynamics force fields rely purely on electrostatics to reproduce these 'bonds', and adding explicit bonds would cause problems when assigning force field parameters.

If a PDB file nevertheless specifies bonds to metal ions (using the 'CONECT' record), YASARA automatically converts them to pseudo-bonds, i.e. plain cylinders that help the visualization but are not part of the soup and ignored for all other purposes with one exception: at the beginning of a simulation, they are used to add distance constraints .

A bond in YASARA has a certain order (single, double, etc.), but contrary to other molecular modeling programs, fractional bond orders somewhere between 'single' and 'double' are also supported. This helps to conserve symmetries and provides a better picture of the underlying chemistry. Bond orders can be visualized by pressing <F2> to show balls & sticks, and coloring bonds by their order .

YASARA uses the following color mapping, described in more detail here :

Name OrderColor
Single bond 1 gray
Resonance bond 1.25blue
Resonance bond 1.33magenta
Resonance bond 1.5 red
Resonance bond 1.66orange
Resonance bond 1.75bright orange
Double bond 2 yellow
Triple bond 3 green
Quadruple bond 4 cyan

Additionally, bond orders (as well as hydrogen atoms ) are assigned in a pH dependent manner. YASARA considers the influence of the pH in two ways:

  • General pH model applied to all molecules: Based on a library of SMILES strings that define protonation patterns and standard pKa values for common functional groups, YASARA assigns bond orders and adds hydrogen atoms according to the currently set default pH. This pH can be changed by clicking on Options > Default pH. If the 'Adjust bond orders and hydrogens' button is checked, YASARA will retype all bonds and reassign all hydrogens to match the new pH. The mentioned SMILES strings can be found in the GROUP_DATA section of the file yasara.def (present in YASARA Dynamics+). A simple example would be that a carboxyl group is neutral below pH 4 and negatively charged above.

  • Specific pH model applied to amino acids: When running molecular dynamics simulations of proteins, the general pH model described above is too crude. Especially active site residues often exhibit large pKa shifts depending on the environment, and instead of the general statement that 'a carboxyl group is neutral below pH 4', one would prefer the specifc conclusion that 'the pKa of residue Glu 42 is raised to 5.1, and a proton sits preferably on the OE1 oxygen'. These pKa predictions are made by the 'cell neutralization experiment', which is used to prepare a molecular dynamics simulation in YASARA Dynamics+. Since pKa predictions are non-trivial, they can be overridden with true experimentally measured pKa values before running the cell neutralization experiment.

As a conclusion, apply first the general pH model , most easily by clicking Edit > Clean > All, then fine-tune the results with the cell neutralization experiment. When this is completed, be careful to not apply the crude general model again, since it does not know about the specific tuning results.

The whole concept behind the general pH model is best illustrated with a few examples:

Figure: Bond orders and protonation patterns of small molecules as a function of pH

The figure above shows seven small molecules at pH 0 to 14.

  • Column 1 - Phenol: All carbon-carbon bonds in the aromatic 6-ring are (roughly) equivalent, the bond order is 1.5 (colored red). From pH 10 on, the hydroxyl group loses the proton.

  • Column 2 - Acetic acid: From pH 0 to 4, the carboxyl group is neutral, one oxygen makes a double bond (yellow), the other one carries a hydrogen. From pH 5 on, the proton is gone and both oxygens are equivalent, making bonds of order 1.5 (red).

  • Column 3 - Imidazole ring: From pH 0 to 6, the ring is protonated, both nitrogens carry a hydrogen and make equivalent bonds of order 1.5 to the carbon in between. The nitrogen valence is thus 3.5, corresponding to a formal charge of +0.5 per nitrogen and +1 in total. From pH 7 on the symmetry is broken, the molecule is neutral, and the nitrogen that does not carry a hydrogen makes a double bond instead.

  • Column 4 - Sulfurous acid: Below pH 2, the molecule is neutral, two oxygens make double bonds, the other two carry hydrogens. From pH 2 to 6, one hydrogen is gone, three oxygens are equivalent due to resonance effects, making bonds of order 1.66 (orange) each. The valence of the sulfur atom stays at 6 (1+3*1.66), and each of the three equivalent oxygens gets a formal charge of -0.33, summing up to -1. From pH 7 on, both hydrogens dissociate, all four oxygens make equivalent bonds of order 1.5 (red). The four resulting formal charges of -0.5 sum up to -2.

  • Column 5 - Guanidinium group: The side-chain of the amino acid arginine is a strong base due to resonance effects. From pH 0 to 12, the group is protonated, each nitrogen makes a bond of order 1.33 (magenta) to the central carbon. The carbon valence is thus normal (4), while each nitrogen has a valence of 3.33, the three resulting formal charges of +0.33 sum up to +1 in total. From pH 13 on, the symmetry is broken, one nitrogen loses a proton and makes a double bond.

  • Column 6 - Carbonic acid: Below pH 7, the molecule is neutral, one oxygen makes a double bond, the other two carry hydrogens. From pH 7 to 10, one hydrogen is gone, two oxygens are equivalent and make bonds of order 1.5 (red). From pH 11 on, both hydrogens dissociate, all three bonds are equivalent with order 1.33 (magenta). The three formal charges on the oxygens (-0.66) sum up to -2.

  • Column 7 - Phosphoric acid: Similar to carbonic acid, just the phosphorus has a valence of 5 and therefore carries an additional hydrogen atom.