Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Bitmap images can be displayed and animated

YASARA can load bitmap images in PNG or (worse, because uncompressed) BMP format. These bitmaps can be displayed as (transparent) back- and foreground graphics or attached as textures to objects.

In practice, you use the LoadPNG and LoadBMP commands to load the image, then show, move or animate it. Objects with attached images need to be created separately.

Example to show five images in a row:


for i=1 to 5
  LoadPNG MyImage(i)
  ShowImage MyImage(i)
  Wait (Button)
  DelImage MyImage(i)