Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

BallStick<Atom|Res|Mol|Obj|All>

-

Style atoms as balls&sticks


CommandArgument DatatypeDefaultMinMax
Format:BallStick<Atom|Res|Mol|Obj|All> Selection SELECTION- - -
Python: BallStick<Atom|Res|Mol|Obj|All>(selection1)
Menu:View > Ball&Stick
Related: Ball , Stick, Style , BallRad, StickRadius
Required:


Setting the style of an atom does not force it to become visible, ShowAtom must be used explicitly. It is perfectly right and often useful to set the style of hidden atoms.

Example:
BallStickObj 1crn

Display object 1crn as balls&sticks.


Example macro:

# EXAMPLE BallStick
Clear
LoadPDB 1crn
Style Stick
HideAtom Sidechain Res !Glu
BallStickRes Glu
PosObj 1crn,Z=20
Figure: Result of the example macro above.