Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

BallRadius

-

Set ball radius in balls&sticks


CommandArgumentDatatypeDefault Min Max
Format: BallRadius percent = percent of space filling radius 10.0-60.0FLOAT---
Python:BallRadius(percent)
Menu:View > Ball&Stick > Parameters
Related:StickRadius , Ball, Stick , BallStick
Required:


The BallRadius command changes the size of those atoms currently displayed as balls and sticks. The size is specified in percent of the full atom size in space filling mode.

If your goal is to display microscopically small atoms, style them as Sticks, and set both the Ballradius and the Stickradius to the minimum values. On screen, the minimum atom radius is one pixel, but in a raytraced screenshot, atoms can be scaled down to sub-pixel size if Antialiasing is enabled.

Example:
BallRadius 20

Draw balls in balls&sticks with 20% of their respective size in space filling mode.