Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Ball<Atom|Res|Mol|Obj|All>

-

Style atoms as balls


CommandArgument DatatypeDefaultMinMax
Format:Ball<Atom|Res|Mol|Obj|All> Selection SELECTION- - -
Python: Ball<Atom|Res|Mol|Obj|All>(selection1)
Menu:View > Ball
Related: BallStick , Stick, Style , BallRad, StickRadius
Required:


Setting the style of an atom does not force it to become visible, ShowAtom must be used explicitly. It is perfectly right and often useful to set the style of hidden atoms.

When displaying atoms as space filling balls , their radii are somewhat smaller than true Van der Waals radii, otherwise you could not see much. They are in fact chosen so that an atom overlap indicates either a bond or a strong bump. You can nevertheless get true Van der Waals radii in the ray-traced output, by setting the ball zoom factor to 1.5.

Example:
BallObj 1crn

Display object 1crn as balls.



Example macro:

# EXAMPLE Ball
Clear
LoadPDB 1c9b
Style Stick
BallRes Ala Val Leu Ile

Figure: Result of the example macro above.