Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

BFactor<Atom|Res|Mol|Obj|All>

-

Set/get the B-factor


CommandArgument DatatypeDefaultMinMax
Format:BFactor<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   value = BFactor to setFLOAT - 0.0999.0
Python:BFactor<Atom|Res|Mol|Obj|All>(selection1,value)
resultlist = BFactor<Atom|Res|Mol|Obj|All>(selection1)
Menu: Edit > Renumber > BFactor
Analyze > BFactor
Related: Occup , Prop, Color , ColorPar
Required:


When coloring by B-factor, a value 0 corresponds to blue (cool, frozen) and 70 to yellow (hot, flexible) by default. Other color schemes can be defined with the ColorPar command.

Some programs read PDB files and expect special values in the occupancy or B-factor fields. A macro showing how to prepare these file can be found at the Occupancy command.

Example 1:
BFactorAtom 128

Get the B-factor of atom 128.


Example 2:
BFactorMol B

Get the average B-factor of molecule B.


Example 3:
BFactorRes Lys Arg

Get the average B-factors of all residues named Lys or Arg.


Example 4:
bf = BFactorObj 1crn

Assign the average B-factor of object 1crn to variable 'bf'.


Example 5:
bflist() = BFactorAtom Obj 1crn

Assign the B-factors of all atoms in object 1crn to the list 'bflist'.


Example 6:
BFactorAtom Backbone,30

Set the B-factors of all backbone atoms to 30.