Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AveragePos<Atom|Res|Mol>

-

Average atom positions


CommandArgument DatatypeDefaultMinMax
Format:AveragePos<Atom|Res|Mol> Atom selection SELECTION- - -
Python: AveragePos<Atom|Res|Mol>(selection1)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:AddPos, RMSF, RMSD
Required:


The AveragePos command calculates and sets the final average atom positions using the data accumulated before with the AddPos command.

The complete procedure for calculating average positions is as follows (and implemented as part of the macro md_analyze):

Use the Clear command to clear the internal atom position table and start a new round of calculations.

Example 1:
AveragePosAtom Obj 1

Move each atom in object 1 to its average positions.


Example 2:
AveragePosRes Obj 1

Move each atom in object 1 to the average position if its residue. This will collapse all residues to single points.