Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AutoRotateTo<Obj|All>

-

Rotate objects or scene automatically to a certain orientation


CommandArgument DatatypeDefaultMinMax
Format:AutoRotateTo<Obj|All> Object selection, SELECTION- - -
   Alpha = Final alpha angle, FLOATCurrent - -
   Beta = Final beta angle,FLOAT Current--
   Gamma = Final gamma angle, FLOATCurrent - -
   Steps = Number of steps till rotation is complete,INT100 - -
   Wait = Wait for completion of rotation Yes | NoSTRINGYes - -
Python: AutoRotateTo<Obj|All>(selection1,alpha=None,beta=None,gamma=None,steps=None,wait=None)
Menu:Effects > Rotate > automatically to
Related:Pos, Move , AutoMove, AutoMoveTo , Ori, Rotate , AutoRotate
Required:


The AutoRotateTo command automatically rotates the selected objects or the scene to the specified orientation in the given number of steps. Then the rotation stops.

The orientation of an object is obtained by placing it at the origin, so that the object's local coordinate system and YASARA's global coordinate system coincide. Then the object is rotated by Alpha degrees about the X-axis, then by Gamma degrees about the Z-axis and finally by Beta degrees about the Y-axis of YASARA's global coordinate system.

Note however that the scene orientation is often reset to 0/0/0 (e.g. if you load another structure or move one single object around). Therefore you must place the AutoRotateTo command at exactly the spot in your macro where you used Ori to get the orientation, otherwise you may end up with an unexpected view.

Example 1:
AutoRotateToObj 1crn,Alpha=20,Beta=180,Gamma=-30,Steps=100

Rotate object 1crn to angles 20/180/-30 in 100 steps.


Example 2:
AutoRotateToAll Beta=10,Steps=200,Wait=No

Rotate entire scene to a Beta angle of 10 in 200 steps, but do not wait till rotation is complete.