Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AutoRotate<Obj|All>

-

Rotate objects or scene automatically


CommandArgumentDatatypeDefault Min Max
Format: AutoRotate<Obj|All> Selection, SELECTION- - -
   X = Angle of rotation about X-axis,FLOATCurrent - -
   Y = Angle of rotation about Y-axis,FLOATCurrent - -
   Z = Angle of rotation about Z-axisFLOATCurrent - -
Python: AutoRotate<Obj|All>(selection1,x=None,y=None,z=None)
Menu:Effects > Rotate > automatically
Related:Pos, Move , AutoMove, AutoMoveTo , Ori, Rotate , AutoRotateTo
Required:


The AutoRotate command starts a permanent rotation of the selected objects or the entire scene about the given axes.

To stop the rotation, use the same command a second time, but specify a rotation angle of 0 degrees.

Example 1:
AutoRotateObj 1crn,X=0.1

Rotate object 1crn by 0.1 degrees about the X-axis of YASARA's global coordinate system every screen update.


Example 2:
AutoRotateAll Z=0.7

Rotate entire scene by 0.7 degrees about the Z-axis of YASARA's global coordinate system every screen update.