Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AutoMoveTo<Obj|All>

-

Move objects or scene automatically to a certain location


CommandArgument DatatypeDefaultMinMax
Format:AutoMoveTo<Obj|All> Selection,SELECTION - --
  X = Final X-position, FLOATCurrent--
  Y = Final Y-position, FLOATCurrent--
  Z = Final Z-position, FLOATCurrent--
  Steps = Number of steps till movement is complete in update cycles, INT100--
   Wait = Wait for completion of movement Yes | NoSTRINGYes - -
Python: AutoMoveTo<Obj|All>(selection1,x=None,y=None,z=None,steps=None,wait=None)
Menu:Effects > Move > automatically to
Related:Pos, Move , AutoMove, Ori , Rotate, AutoRotate , AutoRotateTo
Required:


The AutoMoveTo command automatically moves the selected objects or the scene to the specified position in the given number of steps. Then the movement stops.

All coordinates are given in YASARA's global coordinate system , where 0/0/0 is the window center, the Y-axis points upwards and the Z-axis points into the screen.

Example 1:
AutoMoveToObj 1crn,X=30,Y=-20.5,Z=50,Steps=100

Move object 1crn to coordinates 30/-20.5/50 in 100 steps.


Example 2:
AutoMoveToAll Z=70,Steps=50

Move the rotation center of the entire scene to Z=70 in 50 steps.