Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

AutoMove<Obj|All>

-

Move objects or scene automatically


CommandArgumentDatatypeDefault Min Max
Format: AutoMove<Obj|All> Selection, SELECTION- - -
   X = Step along X-axis, FLOATCurrent - -
   Y = Step along Y-axis, FLOATCurrent - -
   Z = Step along Z-axisFLOAT Current--
Python: AutoMove<Obj|All>(selection1,x=None,y=None,z=None)
Menu:Effects > Move > automatically
Related:Pos, Move , AutoMoveTo, Ori , Rotate, AutoRotate , AutoRotateTo
Required:


The AutoMove command starts a permanent movement of the selected objects or the entire scene with the given speed vector.

To stop the movement, use the same command a second time, setting the speed vector components to 0.

Example 1:
AutoMoveObj 1crn,X=0.1,Y=-0.2,Z=0.5

Add 0.1/-0.2/0.5 A to the position of object 1crn every screen update.


Example 2:
AutoMoveObj 1crn,0,0,0

Stop the movement initiated above.


Example 3:
AutoMoveAll Z=0.7

Add 0.7 A to Z-position of the entire scene every screen update.